Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ230540
Length 567 bp
Fasta Format > rwhdl23c08
atttttacttgtctaaaggnatctgaagagagtcgttgacaggaaaggca aaacatatgctccatagcccatacagttatacccagaataccaatatgat actaatacattgttcgagtgggaagttctggcacaacactgaacaaaaca gggatatcatcagcttagaagagagaggtccccttgcccttcttgtctcc accgatctcaaagtgcttgcacctcttgatagcgcgttgcgagtaatgct tgcagctctggcactgcagcttcagcacaatcttctttgttgtcttggcc ttcttgtggaaaacaggctttgtctggccaccatatcctgactgcttgcg gtcgtaacggcgctttccctgagcagaaagactgtccttgcctttcttgt actgcgtaaccttgtggagggtgtgcttcttgcactccttgttcttgcag taggtcttcttggtctttggaacgttcaccatggtcgccgcctggaagct ctcctccgcgcgtctgcttcttctcctgcggcgtgggcggcggtgaggaa aggggggaagggggagc
Download
page-top