Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ621649
Length 344 bp
Fasta Format > rwhvs10g18
tcgatagacatcaaaacaaagtgataggacatcccaatagcaatacagcc acgactcaacagacagaaaataatagtgcagctctcttagcagcaaaagc aaactagacccatatgataacagaactaaaagtttagagcttgtcctcga aatcagatagaggggtcatctgttccttcagacccttgcgcttgcggatc tccgtgacaagggtcgcagactgggagccggcctccaaaggatccgaaga catgatgtcccagtggtcgaacacacactgggggaaagcctggccagatg tcgcagccctgagggtacttgagaacccgaacgactcgatgacc
Download
page-top