Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ624103
Length 507 bp
Fasta Format > rwhvs19e03
agaaaagagggacatcgctatgcaaaacgctttgatcatctagctgctcc ggcgatcagatcanacgatggcattcgcggcgctggcaatcctgggccac aggtcggcgcactccttcccgatcggtccagtgatggcanaacctttcat ctctccctttgggttcacaatgactccagcattgtcttcaaagtacatga agacaccgtcctttcggcgccacggcttgcgctgcctgacgatgacagcc ggcatgaccttcttcctgaggtcaggctttcccttcttgacagtggccat aaccatgtcaccaacgcaggcagaaggaagcctgttgaggcgccccttga ttcccttcacggagatgatgtacaggttcttggcaccagtgttgtcagca cagttgacagtggctgccaccggcagacccagcgacatccggaacttgtt accagcagaacctccgcgccctcncttcgacatcttggaagagggggtgg tacccgg
Download
page-top