Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ622986
Length 774 bp
Fasta Format > rwhvs15g21
ccacatctatatgtactagtatcaagtagtattaactaaagacagacgca atgacacagaaccatccttcaaaatgaggcaacaagttgagattaacaca gatggcaatacgcggcagggtaactcttgtgatctagtgcttcttgttct tcgggatcttcgacaggaccttctcttcaaagatggcataatacttcttc aattcgatcatggccttctcaccaaaagcatccaccttgtcatcgtactt ctcatacagaactggcacagtgtacagcaccacaaagactatatatgaca gtgtcaaaaagttgcagtagctcccaagaacagaaagaagccagagccct ccaatcacaatgaggaatttcttcagatcacgaccatgaccagtctctct caaggtaaagaagccccggttgatctcatgccgcagtgatagtgcaatgt ttacagtcatgtcctccgggattttcacctcagggatgttcgggggagac ttgtggatgaaaatgcagacattggaatagaggaagagggttgccaggga gaggatgaggcagtggcccaccaaggtgagcagatggtactccatgacct cgaacagcagccagatggcagtagcgccagcaagcacccctccggagacc ttcttgttcctccatagaacaagatcagcaggcttgccgccgccgaggac ggcgtggacgggcttctcgcggccgaagaggcggtagatcttggccttga cgcccgccgccgaccccttcttct
Download
page-top