Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ622749
Length 503 bp
Fasta Format > rwhvs14j18
gctctggnctcacggcataacagtacccagccccacgaatcgcgccacct ccaaatccagagtgaacacatctantacgatccattaaccaatggtagca ctactactaccgtagcagccatagtccagcctagctagaaggagaacgtg aagcgcatgtcgtgtttgtacacctggncgggcctcaccgtcaccgacgg gaactcggggtggttcacggcgtccgggtacgcctgcgtctcgaggcaga acccgccgtactgctcgtacagcttgccgcccttcccctgggtgtggttc anaaagttgccggtgtagagctgcatggccggctggttggcccacagctc cagcgcgcgcccggacttgccgtcccgcgccaccgccancttccgcatgc cctccccgtcnatgacgtaattgatgtcgtacccgtanactttgccgccc atgacctgcctgatgcgcgcgccgattggnatcggcgtgcggaagtctta gct
Download
page-top