Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ622748
Length 714 bp
Fasta Format > rwhvs14j17
tttttaagcaccgatagccgctctggcctcacggcataacagtacccagc cccacgaatcgcgccacctccaaatccagagtgaacacatctagtacgat ccattaaccaatggtagcactactactaccgtagcagccatagtccagcc tagctagaaggagaacgtgaagcgcatgtcgtgtttgtacacctggccgg gcctcaccgtcaccgacgggaactcggggtggttcacggcgtccgggtac gcctgcgtctcgaggcagaacccgccgtactgctcgtacagcttgccgcc cttcccctgggtgtggttcagaaagttgccggtgtagagctgcatggccg gctggttggcccacagctccagcgcgcgcccggacttgccgtcccgcgcc accgccaccttccgcatgccctccccgtcgatgacgtagttgatgtcgta cccgtagactttgccgcccatgacctgcctgatgcgcgcgccgattggca tcggcgtgcggaagtcgtanctggtgccagccacggggtcgacgcggccg gacgacnggagcatctccccgtccagcggggtgtancgggacgcgganag ctggancgtgtggcccangatgtcnccnctgccctccccnnccangttca ngtacacntgctgcaangaanttcancggcntcnccttgttnnncnccgn nncnttcntnnnna
Download
page-top