Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ622654
Length 731 bp
Fasta Format > rwhvs14e11
aatgatcatatgcaagcaagattcatcgnttaaaaaaaggaacaccaaag tacaagttgacattacaagacctcccagtcaaactgggaatacatgctca tgtgaaacagctacaaccaaagattaagagttccatgacaacagccgtgc ttcaatctttaacaacagtccgcaggattttcacttcatggatgggccta tcatttttgtcggtctgaatacttccaaggcgcttaacaatttccattcc tctggatactctcccaaaaattgtgtgcttaccatccagtgattgacaag gtgcaagagtgatgaagaactggctcccgtttgtattcggaccagcgttt gccattgatagaatcccagccccggtgtgcttcagatctggccttatctc gtcctcaaattttgctccgtagatggattcgccgcccctgcctgttccac taggatccccaccttgcacgatgaaatccttgatgatgcggtggaagacg acgttgtcgtagtatttgcggcgcgcgagctcgacgaagttcctgcaggt cttgggcgcgtgcttgtggtacatctcgacggtgaaggcgcccatggagg tctccagggtgacctccggagtccctccgtcgtcgccgccccacatcttg aggtggcgacaggcgagacaagagacggtggcggcggcgcgacaaaggga aagggagccagagggggacggcggcacgagg
Download
page-top