Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ622098
Length 813 bp
Fasta Format > rwhvs12d12
acgaactggttccacgtagtaccacaaacagtctaaccggngcttaatgt ttggccagncaaaagacaaaaccgatacagctaaaacgtgccaaaaccat ccaacgtcgacactaagataaaaacnactaagcggtgcagggcatggaca tctgacgacnacagccgacaggcagccttggcgcttattcgacctcctcc atcttgctctcgccggcgtcntcctccaggggcggnatgtcggtgtcgtt ctctggcncctcgncatcctcatcaatgctcaggccaagcttgagcatgc ggtggatcctggtgccnaaggtgttggggtcctccaggctgaagccggag gtgatcanggaggtctcnaagagnancatcncgaggtccttgacagactt gtcgttcttgtcggcatcggcacgcttacggagctcgtccatgatggcgt tctcagggttgatctccatggtcttcttgctcgacatgtagccagccatg ctcgagtcccttaaggcctgggccttcatgatcctctccatgttggcggt ccacccatattcgccagtcaccanacagcaaggggagtccaccacacggt canagacgataaccttctcaaccttgtcgcccancacctccttgatgacc ttgcacagcccctcaaacttctccttgagctcctcctgcttcttcttctc ntcctcnctctcatcaancttcanaccctccttggtggnananacaanct tcttgccctcaaactccttganctgaccaatggnatactcatcaatggcn tcanccatgtana
Download
page-top