Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ621947
Length 778 bp
Fasta Format > rwhvs11j22
ccaacgacggatacagagctgacgacatgcagttcattgcacggccatga aacatctctagccacgcattcaccaccgcaactactaattgaacagcaaa tccgacacaacgcgacacgacagtacaatagctccttggagcagatgata actaactagcagctgcagtacgactaagatcaccgagcagcaaacttatt aaacacacccagcagctggatctaggggttgtagtagacgatcttgatct cgtcgacgccgtggcacttgccgccggggacggagtgctcgaagcagtgg ccaccgctgttgcagccggcggtggggcagtggtctttcagggggtggcc gtggggggtgatggagacacggatgggcatgtgcgactggtcggtgctca cctggtaccacgccccgccgtcgtacccgatgtggaactccgtcaccacg gcgtcctgcaccttcacgcgccccgtccacgagcacacgtcgtacgacac gtgggtgccgtggcggagcaggtggccagggctgtanagcagcttgctgt tggccagcggctcgatgccgaggtaaaggtccttgccgcacaggttctgc accgtaaccttgcggctcggcttgcanttttggggatcctgaccggcggc ggacatggcantcnctgccancgccacngcnangangananccnccacng ncttgnanaacnccattgnctgttactcnctggttangantnaanannan tgaccctcntnccnaattcctncnnncc
Download
page-top