Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ621832
Length 766 bp
Fasta Format > rwhvs11c03
ancacgagtgttgcaactcgcacggaataactccgaccantcggaagcaa aacaataaccaccacaacctcaagatctcagataacacagacanggtata ataagcagcaggcttcgccgcctctgcaacaagaacaactgactgtttag tcgacctcctcgatcttggggccagggccgccggatgcanctggggtgnc gtcgnccatgccgccctccatgtcggcaccagcaccctggtacatcttgg cgatgatggggttgcacagggcctccanctccttcatcttgtcctcnaac tcatccgcctcancnagntggttcgtgtccanccattggatggcagcatc gatggcatcctcgatcttcttcttgtcgtcggccggcagnttggaggcga tcttcncgtccttgatggnattgcgcatgttgtacgagtagttctcnagg gcattcttggactccgccttcttcttgtgctcctcgcncctccgacttgt acttctcagcctcctggaccatcttctcgatctcctccttgctcagcctg cccttgtcattggtgatggtgatcttgttcttctgcccagtcgtcttgtc ctcancagacacgttcaggataccattggcatcgatgtcaaagcagaccg tgatctggggaactcccctgggtgcgggagggatgccagacagctcgaac ttgccaaggaggttgttgtcaccgggtccttgtcctctcaccctcgtaca cctggatgagcacacc
Download
page-top