Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ626843
Length 758 bp
Fasta Format > rwhvs9e14
ataatatactctaagcaacaatagaacagatatcacaaatgggggaaagg ggagaaaanaaatcacaatgtacgctgctgcaggtttcgtacacagtggt tctcancagcatgggcggctaaccaaaggggcaacaattaatttagatan actcctcccgtcttcatctacaaccaaaaaaatcccatctaaccccctct ggtatttacacnangggggcagatactcttgagcgccgatgatccgatca ncagttgacgccgcactgccccatggcgacggccttctgggtgtcggata tgaacgggtcgatcttcacccacaggagggagaagatggaggcgaggagg atggaccagacgatgacgatggtcggcgtgcggttctgctttcccatgan acccttgaggaaggggtagagatggaggatcacccagatcgagaagaana gctttccnaanagcgggccccangattggtanccgctgttgatggcgtat gatatgccggccaccatgcccacaaggttgatgaccangacggtggtcgg agggatcaggagactggtccacttgaacacgtatanctcggngaagtcgc cgtcctcgtcgttcgccttggatgtgacagngaagttggtgtcgatcccg gccagcaccttgagcagaccctggaacaccgcgaaaagatgggccanatg tgccaccgataacccagaactgctcgtttctccaccaanncctcgatgcc gacaccac
Download
page-top