Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ626610
Length 755 bp
Fasta Format > rwhvs8g17
acgacggatacagagctgacgacatgcagttcattgcacggccatgaaac atctctagccacgcattcaccaccgcaactactaattgaacagcaaatcc gacacaacgcgacacgacagtacaatagctccttggagcagatgataact aactagcagctgcagtacgactaagatcaccgagcagcaaacttattaaa cacacccagcagctggatctaggggttgtagtagacgatcttgatctcgt cgacgccgtggcacttgccgccggggacggagtgctcgaagcagtggcca ccgctgttgcagccggcggtggggcagtggtctttcagggggtggccgtg gggggtgatggagacacggatgggcatgtgcgactggtcggtgctcacct ggtaccacgccccgccgtcgtacccgatgtggaactccgtcaccacggcg tcctgcaccttcacgcgccccgtccacgagcacacgtcgtacgacacgtg ggtgccgtggcggagcaggtggccagggctgtagagcagcttgctgttgg ccagcggctcgatgccgaggtaaaggtccttgccgcacaggttctgcacc gtaaccttgcggctcggcttgcagttttggggatcctgaccggcggcgga catggcantcnctgccancgccacngcnangangananccnccacnggct tgnanaacnccattgnctgttactcnctggttangantgaanangantga ccctc
Download
page-top