Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ626587
Length 898 bp
Fasta Format > rwhvs8f07
atattgtagaaccaacaataacgaactgttccacgagtaccacaaacagc taaccgcgcttaatgtttggccagccaaaagacaaaaccgatacagctaa aacgtgccaaaaccatccaacgtcgacactaagataaaaacaactaggcg gtgcagggcatggacatctgacgacgacagccgacaggcagccttggcgc ttagtcgacctcctccatcttgctctcgccggcgtcgtcctccaggggcg gcatgtcggtgtcgttctctggcgcctcgtcatcctcatcaatgctcagg ccaagcttgagcatgcggtggatcctggtgccgaaggtgttggggtcctc caggctgaagccggaggtgagcagggaggtctcgaagagcagcatcacga ggtccttgacagacttgtcgttcttgtcggcatcggcacgcttacggagc tcgtccatgatggcgttctcagggttgatctccatggtcttcttgctcga catgtagccagccatgctcgagtcccttaaggcctgggccttcatgatcc tctccatgttggcggtccacccatattcgccagtcaccagacagcaaggg gagtccaccacacggtcagagacgataaccttctcaaccttgtcgcccag cacctccttgatgaccttgcacagcccctcaaacttctccttgagctcct cctgcttcttcttctcgtcctcgctctcatcaagcttcagaccctccttg gtggcagagacaagcttcttgccctcaaactccttgagctgaccaatggc atactcatcaatggcgtcanccatgtanatgacctcatagcccttcttct tcagcttctcaaggaagggnagagttctccacaagccnttcttgctct
Download
page-top