Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ626498
Length 902 bp
Fasta Format > rwhvs7p20
cattggtctcatttcatacgaagcaaataacactcagtagtaatactacg aatcaactcgatctaaggtccaaaaacctcacagggcagatatgttatgc ttgctttagctacgacaccatcacggcaacagaaaactgtagatatattg tgcgcccaccgccatcacctgcctcaggaagatttagattttgttgaagg caacaatgtcacagctctggatgtactcgttggctggttcaacgcagaga tggtcttcaataagagtgtcgacagagacgaggtcatcaatgatggtcat cataatctggagcttcttgatgccatatccaacgggcatgagcttggaag caccccacagaaggccctccatcttgatgcttcggacagcttcctccagc ttgaccatgtcggtctcatcgtcccatggcttaacatcaagcaaaactga tgacttgccagattctttcttcttggtagaagcctttgctttggcagcgc gctcttcagctgcctttttctcctcctcggtttcctctccaaaaaggtca acatcgctgtcatcgtcatcatcagctgcaggagcctcagcaacatcagt agttgaggtttcagggacaactgatgacagaaccttcacaccttgaccag gggcagtaactccactcagcttcaggagtgcatcaatgtgattgtaccac cttgcaacattggtgcaagttgatggtggagcaactgagaactctgaata cacagccaagtcatccttggaagcttggtatccagagatgtaactgcgag acagaaggtagccatcaagctttttaaggcctgcctcagcattaacattg aaggtagccgccatctcancctcaaaaggatggaacanatgatctactcc ag
Download
page-top