Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ626317
Length 248 bp
Fasta Format > rwhvs7g01
ataacgaactgttccacgagtaccacaaacagctaaccgcgcttaatgtt tggccagccaaaagacaaaaccgatacagctaaaacgtgccaaaaccatc caacgtcgacactaagataaaaacaactaggcggtgcagggcatggacat ctgacgacgacagccgacaggcagccttggcgcttagtcgacctcctcca tcttgctctcgccggcgtcgtcctccaggggcggcatgtcggtgtcgt
Download
page-top