Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ625737
Length 873 bp
Fasta Format > rwhvs5d04
ataaactttccatggacctctcctcatggtttttatccatgttttttggc agaaaggaaattaaagattgttcagcgggcttcttcctaacccacaagac aaaataaaacagagtgtcgttctcttgtaaaggtaagcttttatttcaag accacatcgaagaagcagacatgagggaaccttcagcggctcagccactg cactctggtgttgatttagatccgaaggcggttagatgtcaaagggtagt ctcaagaatgcctccatttgcttcgccctagtcttgatcgacatgtcaaa caccttctgcccaaattcaatcaccagtcctcccatgatactctggtcaa tcttttgttcaaccaagatggttttgtctttcccaaggatatcacgcaag gtctccttaagttctttctcctccttatcaggaagtggaacaacagtcct gacaacaactttcacctcccccctatgtgccatggtcaaatcaacaaatc tctcagcaatgcgctcaacatatttcagtcttccattggatgccagtgca gacaagaatttctttgtgatgtcagtaaacccggcttcagagaatatttc agttatagccttcaccctggtttctttaggcactgatgtgtccttcatga attgagaaaacatagggctcttcttggatgcccctacaacatcgagaatc tcggattcaactttttccaacgaatttgcgttggctgctgcaaggaacaa cgcactagcatagttgccggtgccaccatacagagcttttggaaccttga tcttgttctccttaggcttatccgcctccgttgccagcccccctcgatac ctgagcgacggccgcggattcgt
Download
page-top