Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ625730
Length 228 bp
Fasta Format > rwhvs5c19
actactaattgaacagcaaatccgacacancgcgacatcgacagtacaat agctccttggagcagatgataactaactagcagctgcagtacgactaaga tcaccgagcancaaacttattaaacacacccagcagctggatctaggggt tgtagtagacgatcttgatctcgtcnacgccgtggcacttgccgccgggg acggagtgctcnaagcagcggcacgagg
Download
page-top