Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ625596
Length 343 bp
Fasta Format > rwhvs4k10
gcntcntgacgcgcatcctccgcatccacaggatcttggtggggagccta gcctccctggtacccctacgcttaccatatccagagtgacggcccttctg cttggcctcatgtgccctccttgcacgagacctggagtggatcttctgag gcttcctgatgatgaaaccatcctttaccagcttccggatgttctgccgg gagttggccatgganatctcnttgacctcattggggtcnagccanacctt gcccttgccgcacttgangacnctcnangccangcncttctgcancttcn ncnacaccatcttcnccnccnctctcctcctcccttanngnca
Download
page-top