Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ625132
Length 813 bp
Fasta Format > rwhvs2o15
ataacgaactgttccacgagtaccacaaacagctaaccgcgcttaatgtt tggccagccaaaagacaaaaccgatacagctaaaacgtgccaaaaccatc caacgtcgacactaagataaaaacaactaggcggtgcagggcatggacat ctgacgacgacagccgacaggcagccttggcgcttagtcgacctcctcca tcttgctctcgccggcgtcgtcctccaggggcggcatgtcggtgtcgttc tctggcgcctcgtcatcctcatcaatgctcaggccaagcttgagcatgcg gtggatcctggtgccgaaggtgttggggtcctccaggctgaagccggagg tgagcagggaggtctcgaagagcagcatcacgaggtccttgacagacttg tcgttcttgtcggcatcggcacgcttacggagctcgtccatgatggcgtt ctcagggttgatctccatggtcttcttgctcgacatgtagccagccatgc tcgagtcccttaaggcctgggccttcatgatcctctccatgttggcggtc cacccatattcgccagtcaccanacagcaaggggagtccaccacacggtc anagacgataaccttctcaaccttgtcgcccancacctccttgatgacct tgcacagcccctcaaacttctccttgagctcctcctgcttcttcttctcn tcctcnctctcatcaagcttcanaccctccttggtggcananacaanctt cttgccctcnaactccttganctgaccaatggcatactcatcaatggcnt cnaccatgtanat
Download
page-top