Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ624934
Length 852 bp
Fasta Format > rwhvs2d06
aaaccgatacagctaaaacgtgccaaaaccatccaacgtcgacactaaga taaaaacaactaggcggtgcagggcatggacatctgacgacgacagccga caggcagccttggcgcttagtcgacctcctccatcttgctctcgccggcg tcgtcctccaggggcggcatgtcggtgtcgttctctggcgcctcgtcatc ctcatcaatgctcaggccaagcttgagcatgcggtggatcctggtgccga aggtgttggggtcctccaggctgaagccggaggtgagcagggaggtctcg aagagcagcatcacgaggtccttgacagacttgtcgttcttgtcggcatc ggcacgcttacggagctcgtccatgatggcgttctcagggttgatctcca tggtcttcttgctcgacatgtagccagccatgctcgagtcccttaaggcc tgggccttcatgatcctctccatgttggcggtccacccatattcgccagt caccagacagcaaggggagtccaccacacggtcagagacgataaccttct caaccttgtcgcccagcacctccttgatgaccttgcacagcccctcaaac ttctccttgagctcctcctgcttcttcttctcgtcctcgctctcatcaag cttcagaccctccttggtggcananacaagcttcttgccctcaaactcct tgagctgaccaatggcatactcatcaatggcgtcaaccatgtanatgacc tcatancccttcttcttcancttctcaaggaanggagagttctccacanc cttcttgctctcaccantgatgtantanatctcnttctgtccctccttca tc
Download
page-top