Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ624403
Length 703 bp
Fasta Format > rwhvs1f04
aacacacacacacctattgctccatgagttaatggtgtgatcgattgaga tcacccaacaccttacagagcgatggattgatagtacctactactctaac tctaaagaaaacttccacaaaccctaacactaaagcaaaaacgacaacaa acggggacaacaagagccacagaggtaaagctcaggagctatctagctgt agtactagtagtagtagtaatatgtatatagtgtttgctcgtgcgtgtgg catggcttgactggaaccagccggcggcaagagtaaccgatggaatgatc gacgacctagtcaccgcgcggcggcgccgcagacgacgtcgtgctcgatc tcggagacggcgccctcgtcgtcgtcgtcgaaactgccatcgcctccggc ggcgccgttgcaaccgaaggcgccgtggccgtgaccgaaggcgcgcgcgt ggtccttgagcgagcgcttgtgcttgaactcggagccgcagaggcagtac cagagcttgccgcagttcttctcgtgggtgcgccagtcgcccttgacggc gaaggccttgccgcaccggcggcagaggaagggcttgaggccgtgcttgc gcttgtagtgcgtctgcagggtgcggaagtccttgagcggcttggcccgt ggatggtcgatgttgttccggcnccccgcngcgcnnantancacngcann cgc
Download
page-top