Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ624401
Length 869 bp
Fasta Format > rwhvs1f02
gtactggactgaacgatttatatattcttcacaaaccacaaccaaaaaag agtacttgattagcaactccattacagatactagttgatgcggaaaacag aaggtaactcatgtccaactaacatgaaccaggcgtcgtctggcgacgcc atccacatttattcttcgcatagacaaagcagggacacctctgaccaggc gccacaaaggaaagcagagcactctactgagtcttggccatgtggcggat caggtcgacaacgcggttgctgtaaccccattcgttgtcataccacgaga caagcttgacgaaatggtcgttcagagcaattccagccttggcatcaaag atgctcgacctgctgtcaccaacaaagtcggtggagaccaaatcctcctc aacgtaacccatgatccccttgagcttcccctcagatgcagccttgatag ccttcttgatgtcatcatatgatgcagccttctcggttctaacagtgaga tcaacaactgacacatccacagtgggaacccggaaagacataccggtaag cttgccattcagctcaggaagaaccttaccaacagccttagcagcaccag tgctgctgggaatgatgttaaagcttgcggccctgccacctctccagtcc ttgctcgagggaccatcaacggtcttctgtgtggcagtgatggcatgaac agtggtcatcaaaccctcaataataccgaagttgtcattaatgatcttag ctaggggagcaaggcagttagtggtgcagctagcatttgagacaatgtta acgtctgaggtgtacttgtcctcgttgacaccaaccacaaacataggggc atctttgcttggggcagag
Download
page-top