Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ624394
Length 864 bp
Fasta Format > rwhvs1e18
ttccaggtcaatagccattaagtaacaagcaaactattccaaaaaaagac caactgtttcgacactgaatttcaagtcctagataggttctttgccaccg tcacgatcccaagcactgctccgcttacttgaagcacttggcgtccagca aggcctgcccctcgaacggctcaaggtcctcgatcatggcttccacgcgc ttcttctgggcctcgtcagagaggtcaaccttggtccactcgtagagctc catgtcatagacctccttcatgacgaactcagggatgtcctgcccacgga agagccacagccccttgaccttgaagggcgcctcagaaccaatcacgagc atcttgccaaaagcatacttgcggcacagatccatccgctgcaggaaccc gccgaccttgttcagggtcacgtacgacacggtgttctcttcctggtact tgtagtcacagaaccacagagagtagccctctgggtcatacatctcccag aaacctttaacagcaacatcatggaagttgctcttagtgtttgagtatag cctcttccagtcatcaagtaccatcttgcttggtggcagtagatcaaggg gatttttgggcttaggctttggtgcctcttcctctggtgcctcaactact gctggctttggggccgccttgggagcctctttcttggcctccttttgttt agcaggagcagccttcttctgaacaggaggtacaacctctgcctgcttga attcgccaatgaccttcttgaagttaggctggttaaccatggtccagaag tacctctcaacatgagggaactcanatgtgaaagtcttgggtcaagatcc gagcaaaaccatgg
Download
page-top