Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ624390
Length 691 bp
Fasta Format > rwhvs1e08
ggataactcgtctgatataaactgggcataacatagcgcaaaattctcat aagatgttggtttaccacacaggaaccaggataacaaactaacgatgtct tgttcaacacaaattgctggtacgggaaacaactaatagttcagatataa tagatctcaaggcacggtcgcgaacagaaccctaggcaacgagcacgaca gcgccgccggcggccttgatcttcttctctgcgatcttggagatgagctt ggccttgacgacgatgggcttctccggcagcatccccttgccgagcacct tgaagtagccgaactgcgagacgtcgaccacgggggccttgtcgccgccg gcctcggccgccttctcggacggcaccatggaccagagcctctcgacgtt gaccgtcggggtgtagaacctgttgctgagcttgtggaagtagcgcatac cgaccttgccgaagtagccgggatggtacttgtcgaagaggatgcggtgg tggtgcatgcctccggcgttaccgcggcctccgggatgcttgcggtgctt gcccacacgcccgtgcccggcggacacgtggccgcgcttcttccggttct tcttgaagcgggtcgtcatcgccgccgctcgctcgccgccgccgcgggct taccttggagganaggggncnggnnngnntctctctctntc
Download
page-top