Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ624389
Length 619 bp
Fasta Format > rwhvs1e07
aatgtcgcggtccattcctttgggctaagctctctctaccggttttgttt tctcctaacacgcctcgctccacacatgacatccccatcttcttccttgg ccgtctcgtctcctttcctctgcgctcttcactccgagtcgctgtccatg ctctccatccctttcagccctcttcgcctcttcttgacacatttcttctc tcgcacctcataccggcccttggtcaaatccgagagccacatccctggaa acacgaattggagcgacttgtccacgttcttggcccgcttcttgggcctc tggggcagcttggtgcccttcatcaccaggaagtcgtcctccttctcctt gcgggacagcgagatgtagatccggggaagctccagccgctccccgccca gcttctcgccggcgcccgtgccgttgccgttggcggcggacgccagctgc gagtcgtggttgttgttgtggtggtggtgggcgttcttggaatccatgtg atgctccgcggcggggggcttgtggtgcggcgccttgtcgggcgacaacc gcttgtgcacnccgcccnatcgntcnncaacgganntgatcncnnaanaa aanatggnntcaatcatgg
Download
page-top