Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ624384
Length 674 bp
Fasta Format > rwhvs1d24
aacaggatctgcaaacaagaacgtcggagtggttgcttcgggcactttgt agtattgcactcgacagctgccgccagtggtcgggtctccgttcatgtca tggctgagagagaatgtggtcaaacgataaagacagcggccaggtcgggg catgactccctcttccttgagctcctgatcagcactgtcgccctcaatgg agacgcactctatcaggcagaatttgctccggcgccccatgtagacgagg gtggcgcttacatgcctctcggctgggtcctcactgagcagtttcatctt gccgagcttcgacttaggggtgtggccagtgtcggagctgggcatgtagc agaagtagagttgtccgaaggtgtctggatctttggagagcccgacaaag gcgcccaggagagggtcaaagtggccgcggccgtggaagggcagcgccca tttgcctacttgtttccatgaaagctttaccgtgtcaaaggcaaacgtgt ccgcaatagctttcttcgtggtgctcaccaggaaggactggctgtagggg ttcaatgcgtaggaggtgacgttgcgaaccttgaacggctgcttcgtgag aacttcccacgaccacctcactctgccagatcgatccggcggcacggggc tgagcagatccaaagagagtatct
Download
page-top