Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ624382
Length 803 bp
Fasta Format > rwhvs1d21
gtatttaaggaaaattgcccagtaacgattcagggcacatactcgaactc aaactcaacccctatgatagtaaatgttttgagaacgctgccgccaacct acgacaacctctggagttcgatgcctccaccaaaaacgaatgttgggaaa atccaccctctacagaaattattgccttccaacgttaaaaagataaaagt tcgccagatccttgaagggcaggactgggaacagacttctcttgttcgtc atcatttcttcccctctaggcaccgcctgagccgtacttcttgccgaaga agaggatctggagctgatcgtagccggagagcacaccagcaccagcaatg gcacggaggatgttggcaccagcacccttgaagagagacttggcaccctc cttcgccaggatctgctggaaagcatccaaggagctcttgtacttgacag cctctccggaggtcatcatcatccttctgcggacggtgtcaatggggtaa gatgcaagaccggcaccgttggtgatcaaccaaccaagagcaaagctggc aaagaagttgtcctggagagtgccagtgaggagaacgggcttcagagaat catacagtccaaagtacagaccacggtagacaatgattccaacacaagag atgttgaatccacggtaaagcccagcaataccatctgacttgagagtctt gcggtagacatcaaccaggccattgaattgcctgtcacctccacccttgg atgcctttgcgtcattggccagccttgtcctagcatagtccagggagtac acg
Download
page-top