Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ624381
Length 718 bp
Fasta Format > rwhvs1d20
agacaagcggcgttgcgtggtaccacggctgcggtacggaccattttatt accatatcaattgatgattacacgagacgagaccagagcacccagacggc aagggaaaacaatcaatagtagtcctgtgtgtttgacacgcctcttgcca cccaccacccaaagacgagagaagagagaccagacaccctgatgacgacg acgatgatgtgacctacctaaacggactacgcgtagtatgcaaccaaacg gaaaaggaaatatcttggaagaatttcgtccaaatcctccaatggccacc accaaacccaacccaccactgatcatcgcacggcgatcggcgctgatcgg cttcagggcttccacaggatggtggtctcggcgatcatcgaggtgaccac gtaggggtccatgttggacgccggccggcggtcctcgaagtagcccttgc cgttctgctccgtctcccggcccacgcgcaccgacgcgccacggttcgcg acaccccagctgaaggtgttgatgtcggcggtctcgtgcttgccggtcag acggcgctcgttgccctcgccgtaggcggcgatgtgctccttgtgcttca gcttgagcttctcgacggcgtccacgatgaccttgaacccgccgtccttc ctcatcgactcggtactgtagtttgtgtgagcaccancaccgttccagtc gcctgggatgggcttggg
Download
page-top