Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ624380
Length 849 bp
Fasta Format > rwhvs1d19
atagcaactttatctgacgaagtttcaccaacacaaccgaacgatactat gaccacagtaataagcagttcgaacactgctcgacacaaataaccaaagc ttaacaagttcgcaaatcggctaacacgactatcaccaccaccgtatacc gccaccaccaccatagatgtggtaaagaaccaccaacaacgccaccgccc gacaccatctcatttcttcttggccgcagccttggtcaccttggcgccgg tcggatccttcttctccacgctcttgatcacgccaacggcgaccgtctgc ctcatgtcacgcacagcaaagcgacccaggggagggtactgggcgaaggt ctccaccaccatgggcttggtggggatcatcttgacgaacccggcatcac cgttcttgaggaacttgggcgccgcctcaatctccttgccagaccgccgg tcgatcttggtctggatctcagcgaacttgacagcgatgtgggacgtgtg gcagtccagcaccggggcgtagccgttgctgatctggccggggtggttca tgatgatgacctgggcggtgaagttggcagcctccttggcggggtcgtcc ttggagttanaggccacgtacccacgcttgagatccttgacagccacatt cttgacgttgaagccgacattatcaccangaagcgcctccanganagact cntggtgcatctccacanacttcacctcantggtcangccantangacca naggtgacaaccatgcctggnttgatgactccantctcancacnccccan tggnacanttccantgccnccaatcttgtannnntcctgaangggaana
Download
page-top