Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ624376
Length 727 bp
Fasta Format > rwhvs1d15
tggccatagtagcagcagcagcagcagcagcagcagcatatattgctgcc aaaagagagctcgtagtaccaccacttctccggtacgtaattacagatat acttgaactaacactacgctactttgccaaggaaggcgaaaccacagacg atgatctggttcagaaaccgccccccaaacgcttattacatcggagcaat cagaagcacgtgaggcggcctagttctccatgcggatgatgcagcggatg ccctcgcccttcgccatgaggtcgaacgccttgttgatctccgagaacgg cacgctgtgtgtgatgaacttctccacctccagctcctttctcatgtaca tctccacgacattgggcaggtcggtgcgcggcttgaagtttccgaagaag gtgcccttgagagtcctctcgttcaggaagttcatcgggtgggtcttgaa ttcggcgtccttgtgcggcacacccaccagcacagcaacaccccagccat catggacacattcaaatgcttgtatcatagcattgacgttgcccgtgcac tcaacactgcggtcaactccaccatttgtcatctcagcgagcacctcctg aactggcttgctgtgatctttcgggttcacaaattccgtgcagccaaatt ttctagcttcttcaaatctgctggcgttcaagtcaataccaatgatccta gatgcacctgcaatccttgcaccttct
Download
page-top