Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ624372
Length 887 bp
Fasta Format > rwhvs1d11
atatatgaccaaatagaagtgtacaccacagntactattctcaccagcat cgttcaattttaaaaagtaaaaaaaaacatcaaacatgggaagcttaccg cccatccgaaaaatcatcatactcatggctatcatacatcatataacttt tttttactgagaagccactattgagaagccatgtgacaattaaccactgc attgtatttcccatcacacaatggacatacataactatcccatataaacc caatcactactttctccagtggctattgccgacaaaattggagcttctca tgtacaccggacaagaaggaacaagcagccgcacagccaccgcacggcaa agcagacgaagaagcccctccctaaccaaacgcaacagcagcagcgcgag tatccttatctccaatagtattttggcctgtgtaggagacaagtgtgcgt ttacatccaggaatttaagcatctgcccagagcaatcccgaccctcttct taacaaccccaggctgctgaaagaaacctgttgcagtccttacatccatc aaagaggatcctactaattcctatgatgggttgtgcatgagcaaaaatca acattaaccaacttggaactttcaaagatctgccccagagtaggcaatgg acatgattatgccacatgctgcaaggccgacaatgacgccaccatcgctg ctgctgatgagcgagggagaatataaagagggcaatattgccataggtgg gcgcaaggttaaagttctccttatctgaaaaatataaagaaatcattcag gaagatgctatcttgcaagcaaataactaacacaactgtactacaaggga aatgaattagtgaagaataattgacctgtattctctg
Download
page-top