Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ624366
Length 896 bp
Fasta Format > rwhvs1d02
actttgaaagatggccagtacagaatgatcttatacatcaggaagaggcg aagagatatgccatgtccagttgtccacaaggagcaacatgctcatagaa ataaaagaagaaagaaatttactctgccttctagaaaaaatcatgccatc tacaatacaacactctgttaatatctactcttgtcagcgccattgcttcg caatctcctcatcaagcatatgggtggcctgctgcctggacctatcatcc agattggtattgcttgccaataaacttcgtagggctcgcagttcatccag gctagctctctggaagagccccctcaggacaatacttggtggattctgag gtagggtatgttgattactagtggcagcatgaggcctgtatctccagtac tctgtacagatgcgatctctatcccgagcctcaattgcccgaactatttc tggtgataagagcccaaacatttcaagaccatcgatagatcctggaggct gcagtgtaggaacgttaggccttcccatactgagttgcctccgtatttcc atgttcagcctctctctgaccatgttccagcacttggtaggcgactcatt aatgaaaacttcacctgggcagttctctacagtaaccataaatagaggtc cttgcaacccagcgtctaatatttcggaaaagtagtatgccatttgaatt ggatccacgatgctccagtattttactctgctcctaaatcctttggggaa gattgcttggcctgaagaccacattctccctgataacacagtaccaattt ccagaggttcaacagagcatttgaatcgatgcacgacatttgctatgcga ggacccctctgtggacctccattcctgttgnggcatttccagagca
Download
page-top