Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ624364
Length 876 bp
Fasta Format > rwhvs1c23
cggggccgaatcaggtacatatccacaaggaccaaaattggagcaagttt gggggtacatatccgttccgttcacataaacatgcgcggcattattgctc aatcctaagagcttcaaccagagttcattccggaggttaaacacacccat tttcacaaaaactcgcgaagataccgtctagtagggctccaccggtgcgc ggaacttgaggccagcatacactgcagcgtcgcccagctcctcctcgatc ctcagaagctggttgtacttggcaagacgctctgaccggcagggagcccc ggtcttgatctgacccgtggacagaccaacagccaaatcagcaatgaatg tgtcctcggtctcaccactcctgtggctggtcatgacaccccagccagca tgttttgacatcttcacggcctcgatactctcagtgacggatccaatttg gttaaccttcagcagaagagcattgcatgacttctcctggattgccttcg caactctggttgggttggtgactagaaggtcatcaccaacaatctgaact tccactccacattcttcagtcatcttagcatagtgcacccagtcatcctg gtcaaatgggtcctcaatcgacacaatggggtactcactcacaaatgact tgtatacgttcttcaggctatctccagatatcttctgagaaccatcattg ttctcctccttgaagttgaggtcataggttttgtccttgtcattgtanaa ctctgaagcancaacatccattccaatgacaaccttgccggtgtatccan ccttttcaattgcantcttcaagagctcaaggccctccttattctcctga atgttaggaagcaaaaaccaccttca
Download
page-top