Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ624362
Length 809 bp
Fasta Format > rwhvs1c20
tagtaatttacatggctaactgaaagctgccgacagacacaatgaaacca aagaccaaaccgtgaacactaaacaaagagcatagatgcacatctcacga ctagcaaacacgattattacgcgagggaagttttctacttttggcttgtg cttctcaagcaccaaatcttaaaacagagagacacacgataaataagagg caatctactcgtccattctcatgatgcagcgcaggccctcccccttgagc atgaggtcgaacgccgtgttgatctgcgagaaaggcacgctgtgggtgat gaacttctccaggtccagctccttcctcatgtacatctccacgacttccg ggaggtcggtccgcggcttgtagttgccgaagaaggtgcccttcagggtc ctctcattgagcaagttcatcgggcttgtcttgaacaccgcctccttgtg cgggacgcccaccagcaccgccacgccccaaccatcatggacacattcga aggcggcgatcatggcgtcgatgtggccagtacactcaaccgcacggtcg acgccgccattggtcatctcgacaagcacctggagagcaacattgcacat tgagtttttggcacaggattgtgcatgtcatgaagaacgaacaaaggtga aaatatgtgttgagggagatggaaagaactcttgcactggcttggtgtgg tcctttgggttcacaaagtcngtgcatccnaatttcttancttgttcnna ttttgcanggntcnnatccncnccnntgatccttgatgccccnnacntct tggcccctt
Download
page-top