Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ624361
Length 779 bp
Fasta Format > rwhvs1c19
aaacgtcatctgaaactgtacaagaaacccctaaccaaagctagctaggc aattatcaaaaaccctactcctttttcctttcaaatatcatctccctcca tttctcttgttgcagaagacgcgccactgaatcagctgcgacactgctct catcaggcttcctggctgccgggcttgatgagcggctgctgcgacgtctt ggcccactcctccggcgggctcttcacctccttgaggaaggccacgacct ccttcatggtcggccgctccgccggcgccgggttcacgcagaagatggcg atgcccagcgtctgcagcatctcctggaccagctggtccggcatgccgcg cagcttggggtccaggatgttcaccgccggctcgtagctccccatcttct tcttggcccactccacgatgtggaggctgtcgctgaccatcggctcgatg gcgctccgcccgctcaggatctccaggagcaccacgccgtagctgtacac gtcgctcttctccgtgatgttcgccgtgtagccgtactctggagcaatgt atccgtaanaaccggcgatgcgcgacatggcatgatgatanttgggggag ttcattancttggccancccaaagtcanccaagtangcctcatacttcna atcaancannatgttgttgcacttgacntcccggnggantatcnncngga cncanncatggngnanatanganannncntgnnnnnnnnnnannnnnatn tnnnannngnnnnnnannnnnngntnnng
Download
page-top