Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ624352
Length 804 bp
Fasta Format > rwhvs1c03
agctgaagctacaacaatgagcaccaaaagtgaaaatcgccaaaaaaaaa tgtacaaaggaggtcaaaggaaatacgggaccgcacttctcggccctcgc atctggttgttctcatccgtctctgtgaagatcttgacatctctttccat agtttcgctgaagcttagtatagaagcaacattcccacatctgtaacaat aattaggtgcagaccacacagttacaagacccttgtctgggaacatgtac tttaggccttcctggactagttgatgagcccgacaaactaactcaagatt gttaacatggttaaactcggttgtcacccgtgatccaaaaagccaacctg ctccacggggactaacaccccatgtctctatctcttctgggtcactccac attagatcacaaaaaggtccttcatgaggaatttcgcagttgcgatcaat tgtccgcatctgatcaactgtgcgtacatcaggtgaaagcccaccatgaa cacagaggactgtgccattaatgattgctgaaagagtaaggtaatcaaaa acatcagtgcaataccgccatgcattcgcatcccatacttcctctgacac tcatcataaaagccatacacctgtgtcaactgtctgctttcatggttccc acgcagaagggttatgtggccaggatacctagcttttanaagcagaagaa tggtgaagacttcaaggctgttgaacccgcggtccacaaagtcgcccatg aatatgtanttggtgtcggggacatggccgccggtggcnaanagcttcat gang
Download
page-top