Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ624348
Length 854 bp
Fasta Format > rwhvs1b22
gagggggtaccacattgtatgacaaataaatgtgctatcttcataactgg aaggtaagaggaatcaatcactttagatgaagaacctggaacataaagat tgacaagatttgataatgacgtgaaggttcaatacactaccgtagaatat tcttcaggtttcagccacttggacaagcaaccacaaagattaagcagaag ggggtatagctttcactgttcgaaatatagatgacctgacgtaatctaaa tttgttaggtggcttcacgagtccaagttcagtgtggcatctgccctggc ctcgatatcgttcttgctcctgacgacgcatctcttctttgtctcgtcgt ccaggtacccgagatcttcagccagtgcaatatgtgcatgcagcagctct tcgagtttgtcagcaggaactgaactcttacctttctcgcatagtatctg atggagttcttccttgccgtggttctcagagctgaaatgatcgtgaattc tcattgcttcctgaaatccagatattgttggtaggaacttgaccacaaac acactctgattggctggtcttccctgggttatctttgccttgtcacatgc aacaccaatatctgcaagtacaccttcgatttcttctattgtcacaatct ttgcttcagagacctttgccttgtttgtgatagagctgttgtgtatcagg acaactggaggccataccatcagatctctcttcatggcatttacttcctc agcgggaacagactgataggctttanaagtgtctggagcaacatgccaat tccaccccatcanaacacagagtgccttgtgaaaacctaaaatgctttgt tttc
Download
page-top