Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ624346
Length 818 bp
Fasta Format > rwhvs1b20
agggaagcaataacacttgaagtcttaggctttcgcattagcactctgga agctacagcctttgccacaatagttgccaaagaaaattagcgcacaccct caatggtgccagagctgaagtaaaccacagatctttcaatggtagaatgt caagagtgagtgtggtcagaggaaaatgccatctctttcgctgatccagc cgtgctgctcttcttactatgttgaaaccgcaacggtgccctcaggaaga gcagagatgtgcacaacaggtgtatgcgattttaatggtatgtcggagcc ggtaaccttcttctccgtcgacctgctcagcaccttcctcacctcatccg caagcacaatgatcgagtcgtcttcatggcttatattggacagtgccttc tccattgagaacaggtagtccctattatatccattagggccactggctgt agcaatttgccttgccatatcctccaaagcagcagggccaagatagtatt tgttgccaactggatcaggagtggatacgaaaactaatacatccgtcaca gctggttccagagaatttccatccttgtagaaatccacagagatcttctg gtcatactcgcattctcttctctccaagtactgcattgcttctcgctctt tttctagaccacctttgacacaataagcaattccccagcatatggcttca tcttcggattcaagggtgcaggtcctggccggatgctgtggtgtgcctct atggtcaatgcaagcaagattaaacgttcgcttgtatcccttgatgaatc ccaggatcttctcgtcga
Download
page-top