Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ624340
Length 765 bp
Fasta Format > rwhvs1b11
aagccgaaattaacacgacagtactcaaatgacacatcaacagggcgcat atcacacggcgctaacagtagcaaaacttaataggcactaaactactaca gatctcaaaagcagacatagatggattcaggtaaacgcctcatttcttct tgatggcagccttggtcaccttggcgccggttgggtccttcttctccaca cccttgatgacaccaacagccacagtttgcctcatgtcccggacagcaaa acgaccaagaggagggtaagtagcaaaggtctccacaaccatgggcttgg tgggaatcatcttcactatgccagcatcaccattcttgaggaacttgggc agggcctccagctccttaccagatcgcctgtcgatcttggtcaccagctc agcaaacttgacagcaatgtgcgaggtgtggcagtccagcactggggcat agccgttgccaatctgaccagggtggttcatgatgatgacctgggaggtg aagttggctgcctccttggcagggtcatccttggagttggatgcaacaaa cccacgcttcagatccttcacggcaacattcttgacgttgaagccgacgt tgtcaccgggaagcgcctccaggagagactcatggtgcatctcaacggac ttgacctcagttgtcagaccagtgggaccaaaggtaacaaccataccagg cttgatgacaccagtctcaacacggccaactggcacagttccaatggaga gagagcggcacgagg
Download
page-top