Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ624339
Length 852 bp
Fasta Format > rwhvs1b10
gagttcgcaaatcaacaaacatcaggcaaaacttaaaaacgatggttcca ggaacataggtctatatccttgcagataactggctatagcaaaacgactc aacacctcagaatcaggccttggcagcagcctgggcagcggcatcccgct tcctctgctcctcaatgatggtgagcttgatacccttgcccttggggagg ctcacccacggcttggtgcccttgccgatggtgaacacgttgcccagacg ggtggcgaactggtggccctgggcatcctcaacgtggatggtctcgaagg ttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttg cgcccaccagtcaccatgaccacgttgccgacgtcaaacttgatgaagtc aacaatcttgttggtctccaggtcaagcttgatggtgtcattggccttga tgagtgggtctgggtagcggatggtgcggccatcataggtgttgaggtat gggatgcccttctggccaaactggacagacctgaccttgcagagcttgaa cttagcatcctcgtccctgacagagtgaaggcggaagcgacccttggtgt catacagaagcctgtanttctcaccantcttgggaatggaaatgatgtcc atgaaaccancanggtangtcttgtcantgcggacctttccatcaaccat aatatgacnctgcataangatanattgcacttcacggtangtganagcat atttcantctgttcctcangatgangatcanangcangcactccctggcc ttgtgaggaccggatgatggcttgngggcaaaanctccaccaancttgtc aa
Download
page-top