Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ624333
Length 807 bp
Fasta Format > rwhvs1a24
atatgagatcatcctcacctactggtccagtcacatgaatttttacaagc caatacaacttttaactgtcggactgaaaccacaaagctataggcctgaa gaacaaaaggcagaaatcctcaaattaactgaccggccacttgtactgga ataacatatctctccgtagcgcattatagcatcatgttaaaccaaccggt ggccaacaaaccagctttgaccaatcaaaaatagatcccacaggaatccc caaagagcaacactgcagctcgtccagagaatatcgtagatgttgctgca agagcccgacccgccgcatcgatgaccagcagtcgacctgcaagagggcg caggtggaggccatgatggccctcgttgacgatgtcgcctacctcgccgg cacctagctcgccactgccaaggcccgagagaggtcatggacttcaaaga aatctgcaacaaatcaaaggagaccgagagggatgtgagagctcacccat ttgcctgccaaatttaggtcccggataaatcctctgctcgctcatcgtct gtcctatatgcagctaacagcagcgcagcagccatccctctcccctgccc tccccgcaccagcagtgcaccagacagtcctcgtcctcatcgatctcccc cactcccgcaaatgtccaacgccctgctatacctccccttatttctcccc tggggcagccggagacgcggctgcgaagccctacccgaaaccctagccat gggggatgggcttgcgagcgggcggtanaggacgggagcggagactctgg ccggagg
Download
page-top