Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728470
Length 715 bp
Fasta Format > whvs20h03
gtcagttttgtctgatgtactgaaacgcagcagctatgatacagaaccca tgttgaaggcatgtggaatttcgatagctcagggctttacacaggtggct ggtagggtactgcaggcccccaagctcaaagctggaaatggtgaagatat tttcacaaggaatggacgttggaatttcaacaacaagaggcttgctagag cttgtgtggtggacagatgggcagttgtaaacttttcggctaggtgtaac accatgaaccttgtcaatgacctcatcaagtgtgggggcatgaagggcaa tacagtagaaaaacctcatattgtaattgaagagaatggttcaatgagac gtgcacctgctccaaaaagggttgaggatatgtttgagcaagtgaagtct aagcttcctggggctccgaagtttctcttgtgtattcttgctgagaggaa gaactcagatgtttatggtccatggaagcgaaaatgccttgctgactttg ggattgtcactcaatgtgtggccccaacaagggtcaatgaccaatatctg acaaatgttctgctgaagatcaatgcaaaacttggtggaatgaactcact actacaaattgaaatgtccccaagtatacctcttgtatcaaaggtcccaa ctctcatcttgggaatggatgtgtcccatggatcccctggacagtctgat ataccgtccattgca
Download
page-top