Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ728445
Length 712 bp
Fasta Format > whvs20f19
cgtgatggagctctgtgcaggcggggagctgtttgatcggattattgcca aggggcactactcagagcgtgcagctgctacaatctgcagaggagttgtg aatgttgtcaatgtttgccatttcatgggagtgatgcaccgcgatctgaa gccggagaacttcttgcttgcgaccaaggatgagaatgcagtgctcaagg ccactgatttcgggctttcggtcttcattgaagaaggaaaaatgtatagg gacatcgttggaagtgcttattatgttgctcctgaagtccttaggagaaa ctatggtaaagagatagatgtttggagtgcaggtgttattctgtacattc ttctcagcggtgttcctccattctgggctgaaactgagaagggaatattt gatgctattcttcaaggggagattgactttgaaagtcagccatggccttc aatttctgagagcgctaaagaccttgtgaggaagatgttggcacaggatc caaagaaaagaattagttcagcccaagttcttcaacatccatggctcagg gaaggagaagcatcagataaacctattgacagtgctgttctttctaggat gaagcaattcanagcaatgaataaactgaaaaagatggctctaaaggtta tagcttcaaatcttaacgaggaagagatcaagggcctgaagccaaatgtt tatgaacntgga
Download
page-top