Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ727800
Length 767 bp
Fasta Format > whvs18o13
ctgcctgccaactagccccaaatctcccctccctcccccgctctcgaatc cccccgagcatcgaccatgtcggcctactgcggaaagtacaaggatgagc tcatcaagaacgctgcctacattggcacccccggcaagggtatccttgct gccgacgagtccaccggcaccatcggcaagcgctttgccagcatcaatgt tgagaatgttgaggacaaccgccgtgccctccgtgagctcctcttctgca cccctggagccctccagtacctcagtggtgtgatcctctttgaggagaca ctgtaccagagcaccaagggtggcaagcccttcgttgacatcctcaagga gggcaacgtcctccctggcatcaaggtggacaagggtaccgtcgagctcg ctggaaccaacggtgagaccaccacccagggctttgatgaccttggcaag cgctgtgccaagtactacgaggctggtgcccgctttgccaagtggcgtgc cgtcctcaagattggccccaccgagccatcacagctttccatcgaccaga atgctcagggtctggctcgctatgccatcatctgccaggagaatgggctg gtgcccattgttgagcctgagatccttgttgatggacctcatgacattga ccgctgtgcttacgtgactgagatggtccttgctgcgtgctacaaggccc tcaacgaccagcatgtcctccttgagggcaccctcctgaagcccaacatg gtcacccctggatccga
Download
page-top