Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ726925
Length 766 bp
Fasta Format > whvs15k23
gtgccgggctgtggagaactctcccttccttgagaagctgaagaagaagg gctatgaggtcatctacatggttgacgccattgatgagtatgccattggt cagctcaaggagtttgagggcaagaagcttgtctctgccaccaaggaggg tctgaagcttgatgagagcgaggacgagaagaagaagcaggaggagctca aggagaagtttgaggggctgtgcaaggtcatcaaggaggtgctgggcgac aaggttgagaaggttatcgtctctgaccgtgtggtggactccccttgctg tctggtgactggcgaatatgggtggaccgccaacatggagaggatcatga aggcccaggccttaagggactcgagcatggctggctacatgtcgagcaag aagaccatggagatcaaccctgagaacgccatcatggacgagctccgtaa gcgtgccgatgccgacaagaacgacaagtctgtcaaggacctcgtgatgc tgctcttcgagacctccctgctcacctccggcttcagcctggaggacccc aacaccttcggcaccaggatccaccgcatgctcaagcttggcctgagcat tgatgaggatgacgaggcgccagagaacgacaccgacatgccgcccctgg aggacgacgccggcgagagcaagatggaggaggtcgactaagcgccaagg ctgcctgtcggctgtcgtcgtcagatgtccatgccctgcaccgcctantt gtttttatcttantgt
Download
page-top