Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ726855
Length 802 bp
Fasta Format > whvs15g21
ggggtcggcggcgggcgtcaaggccaagatctaccgcctcttcggccgcg agaagcccgtccacgccgtcctcggcggcggcaagcctgctgatcttgtt ctatggaggaacaagaaggtctccggaggggtgcttgctggcgctactgc catctggctgctgttcgaggtcatggagtaccatctgctcaccttggtgg gccactgcctcatcctctccctggcaaccctcttcctctattccaatgtc tgcattttcatccacaagtctcccccgaacatccctgaggtgaaaatccc ggaggacatgactgtaaacattgcactatcactgcggcatgagatcaacc ggggcttctttaccttgagagagactggtcatggtcgtgatctgaagaaa ttcctcattgtgattggagggctctggcttctttctgttcttgggagcta ctgcaactttttgacactgtcatatatagtctttgtggtgctgtacactg tgccagttctgtatgagaagtacgatgacaaggtggatgcttttggtgag aaggccatgatcgaattgaagaagtattatgccatctttgaagagaaggt cctgtcgaagatcccgaagaacaagaagcactagatcacaagagttaccc tgccgcgtattgccatctgtgttaatctcaacttgttgcctcattttgaa ggatggttctgtgtcattgcgtctgtctttagttaatactacttgatact antacatatagatgtggtgtgctaatccttttgtgaantggagtcatgcc ag
Download
page-top