Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ726129
Length 514 bp
Fasta Format > whvs12m23
tgtttcggaggcagtgaaggaggagaagagcagtttgtctgatgaggaga agggtgccagcgagaagaaaaagaagaagaagagcaaggaaggcggtgat gatgttgctccagagagtgcggaagttgagaagagcgagaagaaaaagga caagaagaagaagagcaaggaaggtggtgatgatgtcgctacagagagtg aagttgagaagagtgagaagaaaaaggagaagaaaaagaagaagaaagac gcagaggaggcggcacaataggtagagctagtagtttacttcggctggtc atgttatttggttgcaattgtgggcgagtttgagctacctgttttatttg ccctgtaccccttgcaaccgtctatggtttcgtaggcctaatgtactatc gttaggttgctgccattcacctgaaatgctggtaattagagagatttccc attaaatttcttggacaatgaagcttgtttgctttatctgttatcagttg atgcaaaaaaaaaa
Download
page-top