Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ726067
Length 710 bp
Fasta Format > whvs12j06
cgccgcctcctctcgggttccttctccttcctcngagcttcagccatggg taaagagaagactcacatcaacatcgtggtcattggccatgtcgactctg gcaagtcnaccaccactggccatctgatctacaagcttggaggtattgac aagcgtgtgatcgagaggttcgagaaggaagccgccgagatgaacaagag gtctttcaagtacgcctgggtgcttgacaagctgaaggccgagcgtgana ggggtatcaccattgatattgccctgtggaanttcgagaccaccaagtac tactgcaccgtcattgatgctcctggncaccgtgacttcntcaagaacat gattactggtacctcccangctgactgtgctgtgctcatcattgactcca ccactggtggttttgaggctggtatctccaaggatggccagacccgtgag catgccctccttgctttcactcttggagtgaancanatgatctgctgctg taacaagatggacnccaccactcccaagtactcaaaggcccgttatgagg aaattgtcaaggaagtctcttcgtacctgaagaaggtcggctacaaccct gacaaggttccctttgttcccatctctgggtttgagggtgacaacatgat tgagaggtccaccaaccttgactggtacaagggccctacccttcttgagg ctcttgacca
Download
page-top