Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ725957
Length 299 bp
Fasta Format > whvs12d12
atttctgatgatgaagatgaggaggagaagaaggatactgaggagggcaa ggttgaggatgttgatgaggagaaggaanagaangaaaagaanaaaaaga anatcaaggaagtctctcacnagtggaacttggtcaacaancanaagccg atctggatgaggaagccagaggagatcaacaaggaanantacnctgcttt ctacaanagcttgaccaatgactgggangancatttggctgtcaagcact tctctgttganggtcancttganttcaaggctgtcctgtttgtgcccaa
Download
page-top