Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ730684
Length 793 bp
Fasta Format > whvs9o18
ctagccccaaatctcccctccctcccccgctctcgaatccccccgagcat cgaccatgtcggcctactgcggaaagtacaaggatgagctcatcaagaac gctgcctacattggcacccccggcaagggtatccttgctgccgacgagtc caccggcaccatcggcaagcgctttgccagcatcaatgttgagaatgttg aggacaaccgccgtgccctccgtgagctcctcttctgcacccctggagcc ctccagtacctcagtggtgtgatcctctttgaggagacactgtaccagag caccaagggtggcaagcccttcgttgacatcctcaaggagggcaacgtcc tccctggcatcaaggtggacaagggtaccgtcgagctcgctggaaccaac ggtgagaccaccacccagggctttgatgaccttggcaagcgctgtgccaa gtactacgaggctggtgcccgctttgccaagtggcgtgccgtcctcaaga ttggccccaccgagccatcacagctttccatcgaccagaatgctcagggt ctggctcgctatgccatcatctgccaggagaatgggctggtgcccattgt tgagcctgagatccttgttgatggacctcatgacattgaccgctgtgctt acgtgactgagatggtccttgctgcgtgctacaaggccctcaacgaccag catgtcctccttgagggcaccctcctgaagcccaacatggtcacccctgg atccgacgccaagaaggtggcccctgaggtgattgctgagtac
Download
page-top